Quick Order

Mouse Cystatin-E / CST6 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CST6 cDNA Clone Product Information
Gene_bank_ref_id:NM_028623.5
RefSeq ORF Size:450bp
cDNA Description:Full length Clone DNA of Mus musculus cystatin E/M with N terminal Myc tag.
Gene Synonym:ichq, N28197, 1110017E11Rik, Cst6
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cystatin E/M, also referred to as CST6, is a member of type 2 cysteine proteinase inhibitors of the cystatin superfamily, and inhibits papain and cathepsin B. Cystatin E is a low molecular mass secreted protein existing in both a glycosylated (17 kDa) and an unglycosylated (14 kDa) form, with two characteristic intrachain disulfide bridges. Expression of cystatin M/E is found to be restricted to the epidermis, more specifically in the stratum granulosum, sweat glands, sebaceous glands, and the hair follicles. In addition to its function as a cysteine protease inhibitor, cystatin M/E also serves as a target for cross-linking by transglutaminases. Accordingly, cystatin M/E was suggested to be involved in barrier formation and maintenance. Furthermore, studies have revealed that cystatin M/E is frequently epigenetically inactivated during breast carcinogenesis, and thus be regarded as a candidate of tumour suppressor gene.

Size / Price
Catalog: MG50916-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"