After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BGN cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.

Images
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"