Quick Order

Mouse PTP4A2 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PTP4A2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001164745.1
RefSeq ORF Size:504bp
cDNA Description:Full length Clone DNA of Mus musculus protein tyrosine phosphatase 4a2 with N terminal Flag tag.
Gene Synonym:Prl-2
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PRL-2 (Protein-tyrosine phosphatase of regenerating liver 2), also known as PTP4A2 (Protein tyrosine phosphatase type IVA, member 2), is a member of PTP family and has an important function in controlling cell growth. PRL-2 phosphatases may be multifunctional enzymes with diverse roles in a variety of tissue and cell types. The phosphatase of regenerating liver (PRL) family, comprising PRL-1, PRL-2 and PRL-3, is a group of prenylated phosphatases that are candidate cancer biomarkers and therapeutic targets. PRL-1, PRL-2, and PRL-3 represent a novel class of protein-tyrosine phosphatase with a C-terminal prenylation motif. They are three closely related intracellular enzymes that possess the PTP active site signature sequence CX 5R. The PRL-2 mRNA is elevated in primary breast tumors relative to matched normal tissue, and also dramatically elevated in metastatic lymph nodes compared with primary tumors. PRL-2 plays a role in breast cancer progression. PRL-2 is a pathogenic molecule in hematopoietic malignancies and suggest its potential as a novel therapeutic target.

References
  • Akiyama S, et al. (2010) PRL-2 increases Epo and IL-3 responses in hematopoietic cells. Blood Cells Mol Dis. 44(4): 209-14.
  • Hardy S, et al. (2010) Overexpression of the protein tyrosine phosphatase PRL-2 correlates with breast tumor formation and progression. Cancer Res. 70(21): 8959-67.
  • Yuan L, et al. (2007) Differential expression and functional constraint of PRL-2 in hibernating bat. Comp Biochem Physiol B Biochem Mol Biol. 148(4): 375-81.
  • Dumaual CM, et al. (2006) Cellular localization of PRL-1 and PRL-2 gene expression in normal adult human tissues. J Histochem Cytochem. 54(12): 1401-12.
  • Zeng Q, et al. (2000) Prenylation-dependent association of protein-tyrosine phosphatases PRL-1, -2, and -3 with the plasma membrane and the early endosome. J Biol Chem. 275(28): 21444-52.
  • Size / Price
    Catalog: MG52089-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"