Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human WISP1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites

CCN4/Wnt-induced secreted protein 1 (WISP1) is a secreted, cysteine-rich, heparin-binding glycoprotein, belonging to the CCN (CTGF/CYR61/NOV) family of growth factors, and is involved in diverse biological functions such as cell growth, adhesion, migration, angiogenesis, tissue repair, and regulation of extracellular matrix. Members of the CCN family demonstrate high structural homology sharing four conserved cysteine-rich modular domains: a IGFBP (insulin-like growthfactor-binding) domain, a von Willebrand type C domain, a thrombospondin domain and a C-terminal cysteine -knot domain. WISP1 is a putative downstream effector of the Wnt/Frizzled pathway that mediates diversedevelopmental processes, was identified as an oncogene regulated by the Wnt-1-beta-catenin pathway. Thus may contributes to Wnt-1-mediated tumorigenesis and malignance. Expression of WISP1 in some cells results in transformation and tumorigenesis. WISP1 acts to block cell death at a late stage in the p53-mediated apoptosis pathway. It was reported that WISP1 interacts with sulfated glycoconjugates, decorin and biglycan in the ECM of connective tissue, and possibly prevents their inhibitory activity in tumor cell proliferation.

  • Su F, et al. (2002) WISP-1 attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. Genes Dev. 16(1): 46-57.
  • Yanagita T, et al. (2007) Expression and physiological role of CCN4/Wnt-induced secreted protein 1 mRNA splicing variants in chondrocytes. FEBS J. 274(7): 1655-65.
  • Wang H, et al. (2009) Nitric oxide increases Wnt-induced secreted protein-1 (WISP-1/CCN4) expression and function in colitis. J Mol Med. 87(4): 435-45.
  • Venkatachalam K, et al. (2009) WISP1, a pro-mitogenic, pro-survival factor, mediates tumor necrosis factor-alpha (TNF-alpha)-stimulated cardiac fibroblast proliferation but inhibits TNF-alpha-induced cardiomyocyte death. J Biol Chem. 284(21): 14414-27.
  • Images
      Recently Viewed Items