Quick Order

Text Size:AAA

Human CystatinE / CST6 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CST6cDNA Clone Product Information
cDNA Size:450
cDNA Description:ORF Clone of Homo sapiens cystatin E/M DNA.
Gene Synonym:CST6
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 177 C/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human CystatinE / CST6 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Related Products
Product nameProduct name

Cystatin E/M, also referred to as CST6, is a member of type 2 cysteine proteinase inhibitors of the cystatin superfamily, and inhibits papain and cathepsin B. Cystatin E is a low molecular mass secreted protein existing in both a glycosylated (17 kDa) and an unglycosylated (14 kDa) form, with two characteristic intrachain disulfide bridges. Expression of cystatin M/E is found to be restricted to the epidermis, more specifically in the stratum granulosum, sweat glands, sebaceous glands, and the hair follicles. In addition to its function as a cysteine protease inhibitor, cystatin M/E also serves as a target for cross-linking by transglutaminases. Accordingly, cystatin M/E was suggested to be involved in barrier formation and maintenance. Furthermore, studies have revealed that cystatin M/E is frequently epigenetically inactivated during breast carcinogenesis, and thus be regarded as a candidate of tumour suppressor gene.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days