After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACYP2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Degl'Innocenti,D. et al., 2004, IUBMB Life. 56 (1):29-33.
  • Gribenko A.V., et al., 2009, Proc. Natl. Acad. Sci. USA.106:2601-2606.
  • Yeung R.C., et al., 2006, Acta Crystallogr. F 62:80-82.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Images
      Recently Viewed Items