After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSTB cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Cystatin-B, also known as CPI-B, Liver thiol proteinase inhibitor, Stefin-B, CSTB and CST6, is a cytoplasm and nucleus protein which belongs to the cystatin family. Cystatin-B / CSTB is an intracellular thiol proteinase inhibitor. Tightly binding reversible inhibitor of cathepsins L, H and B. Cystatin-B / CSTB is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. Cystatin-B / CSTB is also thought to play a role in protecting against the proteases leaking from lysosomes. Defects in Cystatin-B / CSTB are the cause of progressive myoclonic epilepsy type 1 (EPM1) which is an autosomal recessive disorder characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).

Images
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"