After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ADAMTS5 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADAMTS5cDNA Clone Product Information
cDNA Size:2793
cDNA Description:ORF Clone of Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 5 (ADAMTS5) DNA.
Gene Synonym:ADMP-2, ADAMTS11, FLJ36738, ADAMTS5
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutation 288G/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Size / Price
List Price: $545.00  (Save $150.00)
Price:$395.00      [How to order]
Availability5 business days
    Recently Viewed Items