Quick Order

Mouse GFRA3 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GFRA3 cDNA Clone Product Information
Gene_bank_ref_id:NM_010280.3
RefSeq ORF Size:1194bp
cDNA Description:Full length Clone DNA of Mus musculus glial cell line derived neurotrophic factor family receptor alpha 3 with N terminal Myc tag.
Gene Synonym:Y15110, Gfra3
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 3 (GFRA3) or GDNFRa3 is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA3 / GDNFRa3 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. The neurotrophic growth factor artemin binds selectively to GDNF family receptor α3 (GFRA3 / GDNFRa3), forming a molecular complex with the co-receptor RET which mediates downstream signaling. This signaling pathway has been demonstrated to play an important role in the survival and maintenance of nociceptive sensory neurons and in the development of sympathetic neurons.

References
  • Widenfalk J, et al. (2000) Neurturin, RET, GFRalpha-1 and GFRalpha-2, but not GFRalpha-3, mRNA are expressed in mice gonads. Cell Tissue Res. 299(3): 409-15.
  • Li J, et al. (2009) Autocrine regulation of early embryonic development by the artemin-GFRA3 (GDNF family receptor-alpha 3) signaling system in mice. FEBS Lett. 583(15): 2479-85.
  • Yang C, et al. (2006) Distribution of GDNF family receptor alpha3 and RET in rat and human non-neural tissues. J Mol Histol. 37(1-2): 69-77.
  • Size / Price
    Catalog: MG50901-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"