Quick Order

Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP2K6cDNA Clone Product Information
cDNA Size:1005
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase kinase 6 (MAP2K6) DNA.
Gene Synonym:MEK6, MKK6, MAPKK6, PRKMK6, SAPKK3, MAP2K6
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10422-ACG$325
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10422-ACR$325
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10422-ANG$325
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10422-ANR$325
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10422-CF$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10422-CH$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10422-CM$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10422-CY$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone)HG10422-M$95
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10422-M-F$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10422-M-N$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10422-NF$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10422-NH$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10422-NM$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10422-NY$295
Human MAP2K6 / MKK6 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10422-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Dual specificity mitogen-activated protein kinase kinase 6, also known as MAP kinase kinase 6, MAPKK 6, MAPK / ERK kinase 6, SAPKK3, MAP2K6 and MKK6, is a protein which belongs to the?protein kinase superfamily, STE Ser / Thr protein kinase family and MAP kinase kinase subfamily. MAP2K6 / MKK6 contains one?protein kinase domain. Mitogen-activated protein kinases are members of a conserved cascade of kinases involved in many signal transduction pathways. They stimulate phosphorylation of transcription factors in response to extracellular signals such as growth factors, cytokines, ultraviolet light, and stress-inducing agents. MAP2K6 / MKK6 exists in a variety of alternatively spliced isoforms with distinct patterns of tissue expression. Isoform 2 of MAP2K6 / MKK6 is only expressed in skeletal muscle. Isoform 1 of MAP2K6 / MKK6 is expressed in skeletal muscle, heart, and in lesser extent in liver or pancreas.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
    Recently Viewed Items