Quick Order

Text Size:AAA

Human NAPG Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NAPGcDNA Clone Product Information
Gene_bank_ref_id:BC001889
cDNA Size:939
cDNA Description:ORF Clone of Homo sapiens N-ethylmaleimide-sensitive factor attachment protein, gamma DNA.
Gene Synonym:GAMMASNAP
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

NAPG, also known as gamma SNAP, belongs to the SNAP family. SNAPs enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. NAPG mediates platelet exocytosis and controls the membrane fusion events of this process. It is required for vesicular transport between the endoplasmic reticulum and the Golgi apparatus.

References
  • Lemons PP. et al., 1997, J Cell Biol. 117 (3): 531-8.
  • Chen D. et al., 2001, J Biol Chem. 276 (16): 13127-35.
  • Whiteheart SW. et al., 1992, J Biol Chem. 267 (17): 12239-43.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"