Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HFE2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Hemojuvelin, also known as HFE2, is a membrane-bound and soluble protein which belongs to the repulsive guidance molecule (RGM) family. It is known that RGMs function through Neogenin, a homologue of the Netrin receptor deleted in colon cancer. In mammals, RGM family consists of three glycoproteins which have discrete expression patterns and functions (RGM-A, RGM-B, and RGM-C). Hemojuvelin is expressed in adult and fetal liver, heart, and skeletal muscle. Hemojuvelin acts as a bone morphogenetic protein (BMP) coreceptor. Enhancement of BMP signaling regulates hepcidin (HAMP) expression and iron metabolism. It plays a key role in iron metabolism. Hemojuvelin represents the cellular receptor for hepcidin. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. Defects in hemojuvelin are the cause of hemochromatosis type 2A, also known as juvenile hemochromatosis (JH).

References
  • Papanikolaou G, et al. (2004) Mutations in HFE2 cause iron overload in chromosome 1q-linked juvenile hemochromatosis. Nat Genet. 36(1):77-82.
  • Babitt JL, et al. (2006) Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression. Nat Genet. 38(5):531-9.
  • Zhang AS, et al. (2008) Neogenin-mediated hemojuvelin shedding occurs after hemojuvelin traffics to the plasma membrane. J Biol Chem. 283(25):17494-502.
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"