Quick Order

Text Size:AAA

Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADRA1AcDNA Clone Product Information
cDNA Size:1401
cDNA Description:ORF Clone of Homo sapiens adrenergic, alpha-1A-, receptor (ADRA1A), transcript variant 1 DNA.
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 798G/A not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10404-ACG$325
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10404-ACR$325
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10404-ANG$325
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10404-ANR$325
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10404-CF$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10404-CH$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10404-CM$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10404-CY$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10404-M$95
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10404-M-H$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10404-M-N$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10404-NF$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10404-NH$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10404-NM$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10404-NY$295
Human ADRA1A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10404-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
    Recently Viewed Items