Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL20RA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Background

Interleukin 20 receptor, alpha subunit (IL20RA/IL-20RA) also known as IL-20 receptor subunit alpha, Cytokine receptor class-II member 8, interleukin-20 receptor I, and interleukin-20 receptor subunit alpha, is a subunit for the interleukin-20 receptor. IL20RA/IL-20RA belongs to the type II cytokine receptor family. This cytokine is a receptor for interleukin 20 (IL20), a cytokine that may be involved in epidermal function. The receptor of IL20 is a heterodimeric receptor complex consisting of this protein and interleukin 20 receptor beta (IL20B). IL20RA forms heterodimer with IL20RB, and the complex serves as a receptor for IL19, IL20 and IL24. All three are capable of signaling through IL-20RA/IL-20RB complex. The ligand binding to receptor B creating a high-affinity binding site for the receptor A which is recruited to complete the complex. In addition, IL20RA also forms a heterodimer with the unique and specific receptor IL10RB and functions as the receptor for IL26. IL20RA is widely expressed with highest levels in skin, testis and brain. The expression of both IL20RA and IL20RB is found to be upregulated in psoriatic skin lesions on keratinocytes.

References
  • Parrish-Novak J, et al. (2002) Interleukins 19, 20, and 24 signal through two distinct receptor complexes. Differences in receptor-ligand interactions mediate unique biological functions. J Biol Chem. 277(49): 47517-23.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5): 445-51.
  • Blumberg H, et al. (2001) Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell. 104(1): 9-19.
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"