Quick Order

Mouse TSPAN7 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TSPAN7 cDNA Clone Product Information
Gene_bank_ref_id:NM_019634.2
RefSeq ORF Size:750bp
cDNA Description:Full length Clone DNA of Mus musculus tetraspanin 7 with N terminal Myc tag.
Gene Synonym:A15, Mxs1, PE31, Cd231, TALLA, R74651, Tm4sf2, AI323365, 1200014P11Rik, Tspan7
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

TALLA-1, also known as TSPAN7, is a member of the transmembrane 4 superfamily Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. TALLA-1 gene is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. TALLA-1 is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins.

References
  • Berditchevski F. 2002, J Cell Sci. 114 (23): 4143-51.
  • Castellví-Bel S. et al., 2001, Mol Genet Metab. 72 (2): 104-8.
  • Abidi FE. et al., 2002, J Med Genet. 39 (6): 430-3.
  • Size / Price
    Catalog: MG50879-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"