After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PGD cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
References
  • Baillet A, et al. (2011) Coupling of 6-phosphogluconate dehydrogenase with NADPH oxidase in neutrophils: Nox2 activity regulation by NADPH availability. FASEB J. 25(7): 2333-43.
  • Rho HK, et al. (2005) Transcriptional regulation of mouse 6-phosphogluconate dehydrogenase by ADD1/SREBP1c. Biochem Biophys Res Commun. 332(1): 288-96.
  • Broedel SE, et al. (1990). Genetic tagging, cloning, and DNA sequence of the Synechococcus sp. strain PCC 7942 gene (gnd) encoding 6-phosphogluconate dehydrogenase. J Bacteriol. 172 (7): 4023-31.
  • Adams MJ, et al. (1983). The three dimensional structure of sheep liver 6-phosphogluconate dehydrogenase at 2.6 A resolution. EMBO J. 2 (6): 1009-14.
  • Images
    • Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone) expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"