Quick Order

Text Size:AAA

Human IL22RA1 / IL22R natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL22RA1 cDNA Clone Product Information
RefSeq ORF Size:1725bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 22 receptor, alpha 1 (IL22RA1).
Gene Synonym:IL22R, CRF2-9, IL22R1, IL22RA1
Restriction Site:KpnI + XhoI (5.5kb + 1.73kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 135G/A not causing amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites

IL-22R belongs to the type II cytokine receptor family. It contains 2 fibronectin type-III domains and is expressed in colon, liver, lung, pancreas and kidney. IL-22R also can be expressed in keratinocytes of normal skin as well as in psoriatic skin lesion. Overexpression of IL-22R can be detected in synovial fluid cells from rheumatoid arthritis and spondyloarthropathy patients. IL-22R is a component of the receptor for IL20, IL22 and IL24. The component of IL-22R formed by IL22RA1 and IL10RB enables IL22 signaling via JAK/STAT pathways. IL22 also induces activation of MAPK1/MAPK3 and Akt kinases pathways. Component of one of the receptor for IL20 and IL24 formed by IL22RA1 and IL20RB also signaling through STATs activation. IL-22R mediates IL24 antiangiogenic activity as well as IL24 inhibitory effect on endothelial cell tube formation and differentiation.

  • Xie MH, et al. (2000) Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. J Biol Chem. 275(40):31335-9.
  • Xu W, et al. (2001) A soluble class II cytokine receptor, IL-22RA2, is a naturally occurring IL-22 antagonist. Proc Natl Acad Sci. 98(17):9511-6.
  • Wu PW, et al. (2008) IL-22R, IL-10R2, and IL-22BP binding sites are topologically juxtaposed on adjacent and overlapping surfaces of IL-22. J Mol Biol. 382(5):1168-83.
  • Size / Price
    Catalog: HG10385-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions