Quick Order

Text Size:AAA

Mouse CCR6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
CCR6cDNA Clone Product Information
Gene Bank Ref.ID:NM_001190333.1
cDNA Size:1104
cDNA Description:ORF Clone of Mus musculus chemokine (C-C motif) receptor 6 DNA.
Gene Synonym:CCR-6, KY411, Cmkbr6, CC-CKR-6, Ccr6
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Chemokine & Receptor Related Products
Product nameProduct name
Canine XCL1 Protein (His Tag)Human CXCL2 / MIP-2 ProteinRat CXCL1 / MGSA / NAP-3 ProteinRat CXCL2 / MIP-2 ProteinHuman CCL20 / MIP-3 alpha Protein (His Tag)Rat CCL3 / Mip1a ProteinHuman FAM19A4 / TAFA4 Protein (Fc Tag)Human CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL23 / MIP 3 Protein (His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 49-109, His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 40-113, His Tag)Mouse CCL22 / MDC Protein (His Tag)Mouse CXCL14 / BRAK ProteinMouse CXCL1 / MGSA / NAP-3 ProteinHuman NAP-2 / PPBP / CXCL7 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human I-309 / CCL1 / TCA-3 Protein (Fc Tag)Human I-309 / CCL1 / TCA-3 ProteinHuman CCL13 / MCP-4 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human CXCL12 / SDF1b Protein (Fc Tag)Human CXCL12 / SDF-1 ProteinHuman CCL18 / PARC / MIP4 Protein (His Tag)Human CCL22 / MDC Protein (His Tag)Human CCL17 / TARC / SCYA17 Protein (His Tag)Human CCL17 / TARC / SCYA17 ProteinHuman CCL11 Protein (His Tag)Human CCL14 / HCC-1 / HCC-3 Protein (His Tag)Human CCL14 / HCC-1 / HCC-3 Protein (aa 28-93, His Tag)Human CCL21 / 6Ckine ProteinMouse CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL27 / CTACK Protein (His Tag)Human Fractalkine / CX3CL1 Protein (His Tag)Human XCL1 Protein (His Tag)Human CXCL10 / Crg-2 ProteinHuman CXCL4 / PF4 ProteinHuman CXCL1 / MGSA / NAP-3 Protein (His & NusA Tag)Human CXCL1 / MGSA / NAP-3 Protein (His & SUMO Tag)Human CXCL14 / BRAK ProteinHuman CXCL9 / MIG / C-X-C motif chemokine 9 ProteinHuman CXCL5 ProteinHuman CCL15 / MIP-5 / MIP-1 delta Protein (aa 22-113, His Tag)Human CCL15 / MIP-5 / MIP-1 delta Protein (aa 46-113, His Tag)Human CCL5 / RANTES Protein (His & mucin Tag)Human CCL24 / Eotaxin-2 / MPIF-2 Protein (His Tag)Human CCL8 / MCP-2 Protein (SUMO Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL4 / MIP1B Protein (His Tag)Human CCL3 / Mip1a Protein (His Tag)Human CXCL3 / GRO gamma Protein (His Tag)Human FAM19A2 Protein (Fc Tag)Human MCP-3 / CCL7 Protein (His Tag)Human MCP-3 / CCL7 Protein (His Tag)Cynomolgus / Rhesus Fractalkine / CX3CL1 Protein (Fc Tag)Human XCL2 Protein (His Tag)Human CXCL12 / SDF-1 Protein (isoform a, His Tag)Human CXCL12 / SDF-1 Protein (isoform a)Human CXCL1 / MGSA / NAP-3 ProteinMouse CXCL12 / SDF-1 ProteinMouse CCL6 / C-C motif ligand 6 Protein (His Tag)Mouse CCL17 / TARC ProteinMouse CCL20 / MIP-3 alpha Protein (His Tag)Mouse CXCL2 / GRO2 / MIP-2 (His & SUMO Tag)Mouse CXCL16 / SR-PSOX Protein (His Tag)Mouse CXCL9 / MIG / C-X-C motif chemokine 9 ProteinMouse I-309 / CCL1 / TCA-3 Protein (Fc Tag)Mouse CCL8 / MCP-2 Protein (His & NusA Tag)Mouse XCL1 Protein (His Tag)Human CCL28 Protein (His Tag)Mouse CCL3 / Mip1a ProteinCanine IL-8 / CXCL8 ProteinCanine CXCL12 / SDF-1 ProteinCanine CXCL13 / BCA-1 Protein (His Tag)Canine CXCL16 / SR-PSOX Protein (His Tag)Rat NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Rat CXCL16 / SR-PSOX Protein (Fc Tag)Rat CXCL16 / SR-PSOX Protein (His Tag)Cynomolgus CXCL12 / SDF-1 Protein (Fc Tag)Cynomolgus CXCL13 / BCA-1 / BLC Protein (His Tag)Cynomolgus CCL17 / TARC Protein (His Tag)Cynomolgus XCL1 Protein (His Tag)Cynomolgus NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Cynomolgus CXCL9 / MIG / C-X-C motif chemokine 9 ProteinCynomolgus CCL21 / 6Ckine ProteinCynomolgus IL-8 / CXCL8 ProteinMouse MCP-3 / CCL7 Protein (His Tag)Human CCL5 / RANTES ProteinHuman CCL23 / MIP 3 Protein (His Tag)Human CCL23 / MIP 3 ProteinCanine CXCL16 / SR-PSOX Protein (Fc Tag)Canine Fractalkine / CX3CL1 Protein (Fc Tag)Canine Fractalkine / CX3CL1 Protein
Size / Price
Catalog:MG50872-NM
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availsability:2-3 weeks
Images
    Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"