Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GZMH cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Granzymes are key components of the immune response that play important roles in eliminating host cells infected by intracellular pathogens. Several granzymes are potent inducers of cell death. A total of eight granzymes (A-G and M) have been identified in the mouse, but only five are known in humans (A, B, H, M and granzyme 3), and granzyme H appears to be specifically human. Human granzyme H is a neutral serine protease that is expressed predominantly in the lymphokine-activated killer (LAK)/natural?killer (NK) compartment of the immune system. In adenovirus-infected cells in which granzyme B (gzmB) and downstream apoptosis pathways are inhibited, granzyme H directly cleaves the adenovirus DNA-binding protein (DBP), a viral component absolutely required for viral DNA replication. This virus demonstrated that gzmH directly induces an important decay in viral DNA replication. Interestingly, gzmH also cleaves the adenovirus 100K assembly protein, a major inhibitor of gzmB, and relieves gzmB inhibition. Granzyme H has a very high amino acid identity (>90%) with many portions of the granzyme B sequence, particularly near the amino terminus of the molecule despite performing a distinct enzymic function.

    Recently Viewed Items