After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ICOS cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Inducible costimulator (ICOS), also called AILIM (activiation-inducible lymphocyte immunomediatory molecule) is a cell-surface receptor, and belongs to the CD28 family of immune costimulatory receptors consisting of CD28, CTLA-4 and PD-1. The interaction of B7-H2/ICOS plays a critical role in Th cell differentiation, T−B cell interactions which is essential for germinal center formation, and humoral immune responses, and as well as the production of cytokine IL-4. In addition, ICOS is more potent in the induction of IL-10 production, a cytokine important for suppressive function of T regulatory cells. The B7-1/B7-2--CD28/CTLA-4 and ICOS-B7RP-1 pathway provides key second signals that can regulate the activation, inhibition and fine-tuning of T-lymphocyte responses. ICOS stimulates both Th1 and Th2 cytokine production but may have a preferential role in Th2 cell development. Moreover, The B7-1/B7-2-CD28/CTLA-4 and ICOS-B7RP-1 pathway has been suggested of being involved in the development of airway inflammation and airway hyperresponsiveness.

  • Coyle AJ, et al. (2004) The role of ICOS and other costimulatory molecules in allergy and asthma. Springer Semin Immunopathol. 25(3-4): 349-59.
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • van Berkel ME, et al. (2006) CD28 and ICOS: similar or separate costimulators of T cells Immunol Lett. 105(2): 115-22.
  • Images
      Recently Viewed Items