Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DIABLO cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-GFPSpark tagHG10339-ACG$325
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10339-ACR$325
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-GFPSpark tagHG10339-ANG$325
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10339-ANR$325
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-Flag tagHG10339-CF$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-His tagHG10339-CH$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-Myc tagHG10339-CM$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-HA tagHG10339-CY$295
Human SMAC / Diablo transcript variant 1 Gene cDNA clone plasmidHG10339-M$95
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, Flag tagHG10339-M-F$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-Flag tagHG10339-NF$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-His tagHG10339-NH$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-Myc tagHG10339-NM$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-HA tagHG10339-NY$295
Human SMAC / Diablo transcript variant 1 natural ORF mammalian expression plasmidHG10339-UT$295
 Learn more about expression Vectors
Product nameProduct name

Apoptosis is an essential processes required for normal development and homeostasis of all metazoan organisms. Second Mitochondria-Derived Activator of Caspases (Smac) or Direct IAP Binding Protein with low isoelectric point, pI (Diablo) is a proapoptogenic mitochondrial protein that is released to the cytosol in response to diverse apoptotic stimuli, including commonly used chemotherapeutic drugs. The current knowlege about structure and function of Smac/Diablo during programmed cell death, both in mitochondrial and receptor pathways are presented. It has been shown that Diablo mainly interacts with IAPs in the cytochrome c/Apaf-1/caspase-9 pathway, and promotes apoptosis. Diablo is released from the mitochondria into the cytosol occurring downstream of cytochrome c release in response to apoptotic stimuli such as irradiation, DNA damage or cytotoxic drugs. In the cytosol, Smac/Diablo interacts and antagonizes inhibitors of apoptosis proteins (IAPs), thus allowing the activation of caspases and apoptosis. This activity has prompted the synthesis of peptidomimetics that could potentially be used in cancer therapy. The role of Smac/DIABLO in colorectal carcinogenesis is ill defined. Data continues to accumulate to suggest that decreased levels of Smac/DIABLO may be important in chemoradiation-resistance to apoptosis in advanced colon cancer.

  • Korga A, et al. (2006) Role of mitochondrial protein Smac/Diablo in regulation of apoptotic pathways Pol Merkur Lekarski. 20(119): 573-6.
  • Anguiano-Hernandez YM, et al. (2007) Smac/DIABLO and colon cancer. Anticancer Agents Med Chem. 7(4): 467-73.
  • Martinez-Ruiz G, et al. (2008) Role of Smac/DIABLO in cancer progression. J Exp Clin Cancer Res. 27: 48.
  • Images
      Recently Viewed Items