Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IDS cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Iduronate 2-Sulfatase, also known as IDS, is a member of the highly conserved sulfatase family of enzymes that catalyze the hydrolysis of O- and N-sulfate esters from a variety of substrates. The human Iduronate 2-Sulfatase/IDS consists of a signal peptide, a pro peptide and a mature chain that may be further processed into two chains. Among the identified 18 human sulfatases, Iduronate 2-Sulfatase/IDS is required for the lysosomal degradation of the glycosaminoglycans (GAG), heparan sulfate and dermatan sulfate. Multiple mutations in this X-chromosome localized gene result in Iduronate 2-Sulfatase/IDS enzymatic deficiency, and lead to the sex-linked Mucopolysaccharidosis Type II (MPS II ), also known as Hunter Syndrome characterized by the lysosomal accumulation of the GAG and their excretion in urine. MPS II has a wide spectrum of clinical manifestations ranging from mild to severe due to the level of Iduronate 2-Sulfatase/IDS enzyme. Retroviral-mediated Iduronate 2-Sulfatase/IDS gene transfer into lymphoid cells would be a promising gene therapeutic strategy.

    Recently Viewed Items