Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ICAM2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Intercellular adhesion molecule 2 (ICAM-2, CD102), belongs to the ICAM family consisting of three members identified as ligands for integrin receptors. It is a type I transmembrane glycoprotein with two Ig-like C2-type domains, and binds to the leukocyte integrins LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). As a second ligand of leukocyte function-associated antigen-1, ICAM-2 functions as a costimulatory molecule for effector cells. ICAM-2 is mainly expressed on vascular endothelial and hematopoietic cells. Interactions of ICAM-2 and the integrin receptors mediate cell adhesion in a wide range of lymphocyte, monocyte, natural killer cell, and granulocytewith other cells, and play important roles in many adhesion-dependent immune and inflammation responses, such as T cell aggregation, NK-cell cytotoxicity and migration, lymphocyte recirculation, etc. Serum levels of ICAM-2 correlated significantly with the inflammatory and course sequences of trichinosis in mice and had a similar relation with blood eosinophilia. So, estimation of ICAM-2 serum levels may prove useful in diagnosis of trichinosis recent infections, and in monitoring the prognosis and response to treatment.

  • Weber KS, et al. (2004) Sialylation of ICAM-2 on platelets impairs adhesion of leukocytes via LFA-1 and DC-SIGN. Inflammation. 28(4): 177-88.
  • Tanaka H, et al. (2004) ICAM-2 gene therapy for peritoneal dissemination of scirrhous gastric carcinoma. Clin Cancer Res. 10(14): 4885-92.
  • Younis AI, et al. (2005) Intercellular adhesion molecule-2 (ICAM-2) in experimental trichinosis. J Egypt Soc Parasitol. 35(3): 1019-26.
  • Images
      Recently Viewed Items