Quick Order

Human GFRA2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GFRA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001495.4
RefSeq ORF Size:1395bp
cDNA Description:Full length Clone DNA of Homo sapiens GDNF family receptor alpha 2.
Gene Synonym:NTNRA, RETL2, TRNR2, GDNFRB, NRTNR-ALPHA
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-GFRA2
Restriction Site:KpnI + XhoI (5.5kb + 1.4kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Background

GFRA2 is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA2 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA/GDNFRa acts as the ligand-binding component. Experiments have improved that GFRA2 genetic variants and age may play a role in Tardive dyskinesia (TD) susceptibility, but further work is required to confirm these findings.

References
  • Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.
  • Souza RP, et al. (2010) Glial cell line-derived neurotrophic factor receptor alpha 2 (GFRA2) gene is associated with tardive dyskinesia. Psychopharmacology. 210(3): 347-54.
  • Vanhorne JB, et al. (2001) Cloning and characterization of the human GFRA2 locus and investigation of the gene in Hirschsprung disease. Hum Genet. 108(5): 409-15.
  • Size / Price
    Catalog: HG10331-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"