Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GFRA1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Background

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 1 (GFRA1) is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA1 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. GDNF, a distantly related member of the transforming growth factor-β (TGF-â) superfamily, and its receptor components: GFRA1, Ret and neural cell adhesion molecule (NCAM) have been recently reported to be expressed in the testis and to be involved in the proliferation regulation of immature Sertoli cells.

References
  • Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.
  • Jing S, et al. (1996) GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell. 85(7):1113-24.
  • Treanor JJ, et al. (1996) Characterization of a multicomponent receptor for GDNF. Nature. 382(6586): 80-3.
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"