Quick Order

Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OPCMLcDNA Clone Product Information
Gene_bank_ref_id:NM_002545.3
cDNA Size:1038
cDNA Description:ORF Clone of Homo sapiens opioid binding protein/cell adhesion molecule-like transcript variant 1 DNA.
Gene Synonym:OPCM, OBCAM
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10328-ACG$325
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10328-ACR$325
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10328-CF$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10328-CH$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10328-CM$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10328-CY$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10328-M$95
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10328-M-F$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10328-M-N$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10328-NF$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10328-NH$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10328-NM$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10328-NY$295
Human OBCAM / OPCML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10328-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).

References
  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • Size / Price
    Catalog:HG10328-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"