Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HBEGF cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human NRG1 Protein (His Tag, ECD)Mouse EGFL6 / EGF-L6 Protein (His Tag)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinHuman EGFL6 / EGF-L6 Protein (Flag & His Tag)Human HER2 / ErbB2 Protein (ECD, domain IV) (His Tag)Mouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinRhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGF / Epidermal Growth Factor ProteinHuman EGFL7 / VE-statin Protein (His Tag)Rat HER2 / ErbB2 ProteinRat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Human Epiregulin / EREG Protein (Fc Tag)Mouse EGFL7 / VE-statin Protein (His Tag)Human HBEGF / DTR ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Human HER2 / ErbB2 Protein (ECD, domain I) (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Human NRG1-beta 1 Protein (ECD)Mouse HER4 / ErbB4 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Human BTC / Betacellulin Protein (Fc Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinCanine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human BTC / Betacellulin ProteinMouse EGF / Epidermal Growth Factor ProteinHuman EGFL6 / EGF-L6 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinCanine NRG1-alpha Protein (ECD)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)

Heparin-binding EGF-like growth factor (HBEGF), a member of the EGF family of growth factors, exerts its biological activity through activation of the EGFR and other ErbB receptors. Soluble mature HBEGF is proteolytically processed from a larger membrane-anchored precursor and is a potent mitogen and chemotactic factor for fibroblasts, smooth muscle cells but not endothelial cells. HBEGF activates two EGF receptor subtypes, HER1 and HER4 and binds to cell surface HSPG. The transmembrane form of HBEGF is a juxtacrine growth and adhesion factor and is uniquely the receptor for diphtheria toxin. Both forms of HB-EGF participate in normal physiological processes and in pathological processes including tumor progression and metastasis, organ hyperplasia, and atherosclerotic disease. HBEGF participates in diverse biological processes, including heart development and maintenance, skin wound healing, eyelid formation, blastocyst implantation, progression of atherosclerosis and tumor formation, through the activation of signaling molecules downstream of ErbB receptors and interactions with molecules associated with HBEGF. tumor necrosis factor-alpha (TNF-alpha) and interleukin-1 beta markedly increased HB-EGF mRNA levels in HUVEC by 12- and 7-fold, respectively, and induction of the gene by TNF-alpha was both dose- and time-dependent.

  • Miyamoto S, et al. (2006) Heparin-binding epidermal growth factor-like growth factor as a novel targeting molecule for cancer therapy. Cancer Sci. 97(5): 341-7.
  • Raab G, et al. (1997) Heparin-binding EGF-like growth factor. Biochim Biophys Acta. 1333(3): 179-99.
  • Pathak BG, et al. (1995) Mouse chromosomal location of three EGF receptor ligands: amphiregulin (Areg), betacellulin (Btc), and heparin-binding EGF (Hegfl). Genomics. 28(1): 116-8.
  • Images
        Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.