After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CALU ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CALU cDNA Clone Product Information
Gene_bank_ref_id:BC013383
RefSeq ORF Size:948bp
cDNA Description:Full length Clone DNA of Homo sapiens calumenin with N terminal HA tag.
Gene Synonym:CALU
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Calumenin belongs to the CREC family. It contains 6 EF-hand domains. Calumenin is expressed in skeletal muscle (at protein level). Calumenin interacts with GGCX and RYR1 in the presence of calcium ions, but not in the presence of EDTA. Calumenin is Involved in regulation of vitamin K-dependent carboxylation of multiple N-terminal glutamate residues. It seems to inhibit gamma-carboxylase GGCX. Calumenin also binds 7 calcium ions with a low affinity and may modulate calcium release from the sarcoplasmic reticulum.

References
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10 (11):1788-95.
  • Vorum H, et al. (2000) Calumenin interacts with serum amyloid P component. FEBS Lett. 465 (2-3):129-34.
  • Vorum H, et al. (1999) n calumenin localizes to the secretory pathway and is secreted to the medium. Exp Cell Res. 248(2):473-81.
  • Size / Price
    Catalog: HG13486-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"