Quick Order

Text Size:AAA

Human HAPLN1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HAPLN1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001884.3
RefSeq ORF Size:1065bp
cDNA Description:Full length Clone DNA of Homo sapiens hyaluronan and proteoglycan link protein 1.
Gene Synonym:CRTL1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-HAPLN1
Restriction Site:KpnI + XhoI (5.5kb + 1.07kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Hyaluronan (HA) is a high MW glycosaminoglycan significantly involved in the formation and stability of extracellular matrix via its association with specific HA-binding proteins. HAPLN1, also known as CRTL1 (Cartilage Link Protein 1, cLP ) and link protein, is a member of HA-binding protein (hyaladherins) family, and contains a common structural domain of about 100 amino acids that is termed a Link module with two α-helices and two antiparallel β-sheets. HAPLN1/CRTL1 stabilizes the interaction between hyaluronan (HA) and versican, two extracellular matrix components essential for cardiac development. Link module superfamily can be divided into three subgroups, and the HAPLN family are C domain-type proteins that have an extended structure with one N-terminal V-type Ig-like domain followed by two link modules. In cartilage, aggrecan forms - cLP stabilized aggregates with HA that provides the tissue with its load bearing properties. HAPLN1 is a component of follicular matrix, was shown to enhance cumulus-oocyte complex (COC) expansion in vitro. HAPLN1 may promote periovulatory granulosa cell survival, which would facilitate their differentiation into luteal cells.

References
  • Sun GW, et al. (2003) Follicle-stimulating hormone and insulin-like growth factor I synergistically induce up-regulation of cartilage link protein (Crtl1) via activation of phosphatidylinositol-dependent kinase/Akt in rat granulosa cells. Endocrinology. 144(3): 793-801.
  • Wirrig EE, et al. (2007) Cartilage link protein 1 (Crtl1), an extracellular matrix component playing an important role in heart development. Dev Biol. 310(2): 291-303.
  • Liu J, et al. (2010) Periovulatory expression of hyaluronan and proteoglycan link protein 1 (Hapln1) in the rat ovary: hormonal regulation and potential function. Mol Endocrinol. 24(6): 1203-17.
  • Size / Price
    Catalog: HG10323-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"