Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CDH12 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Classic Cadherins represent a family of calcium-dependent homophilic cell-cell adhesion molecules. They confer strong adhesiveness to animal cells when they are anchored to the actin cytoskeleton via their cytoplasmic binding partners, catenins. The cadherin/catenin adhesion system plays key roles in the morphogenesis and function of the vertebrate and invertebrate nervous systems. Furthermore, this system is involved in synaptic plasticity. Recent studies on the role of individual cadherin subtypes at synapses indicate that individual cadherin subtypes play their own unique role to regulate synaptic activities. Type II (atypical) cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. It has been observed that cells containing a specific cadherin subtype tend to cluster together to the exclusion of other types, both in cell culture and during development. Cadherin-12 also known as CDH12, is a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Cadherin-12 appears to be expressed specifically in the brain and its temporal pattern of expression would be consistent with a role during a critical period of neuronal development, perhaps specifically during synaptogenesis.

  • Tanihara H, et al. (1994) Cloning of five human cadherins clarifies characteristic features of cadherin extracellular domain and provides further evidence for two structurally different types of cadherin. Cell Adhes Commun. 2(1): 15-26.
  • Suzuki SC, et al. (2008) Cadherins in neuronal morphogenesis and function. Dev Growth Differ. 50 Suppl 1: S119-30.
  • Images
      Recently Viewed Items