After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINA3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Human SerpinA3, also known as Alpha 1-antichymotrypsin (AACT), is a plasma alpha globulin glycoprotein, and is a member of serpin superfamily of the serine protease inhibitors consisting of at least 35 members. SerpinA3 has been demonstrated to inhibit the activity of certain serine proteases, such as cathepsin G found in neutrophils, and chymases present in mast cells, by inducing a major conformational rearrangement, and thus protects some tissues from damage caused by proteolytic enzymes. This enzyme is produced primarily in the liver, and is identified as an acute-phase inflammatory protein. SerpinA3 deficiency has been associated with liver disease, and mutations of this gene have been observed in patients with Parkinson disease and chronic obstructive pulmonary disease. In addition, ACT gene polymorphism has been implicated with Alzheimer’s disease (AD), cerebral amyloid angiopathy (CAA), as well as stroke, since SerpinA3 is a major constituent of the plaques in AD and an inhibitor of amyloid beta peptide degradation.

  • Nilsson, L.N. et al., 2001, J. Neurosci. 21: 1444-1451.
  • Ikari, Y. et al., 2001, J. Biol. Chem. 276: 11798-11803.
  • Vila, N. et al., 2000, Stroke. 31: 2103-2105
  • Eriksson, S. et al., 1995, Proc. Natl. Acad. Sci. USA. 92: 2313-2317.
  • Skeel, A. et al., 2001, J. Biol. Chem. 276: 21932-21937.
  • Images
      Recently Viewed Items