Quick Order

Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTNcDNA Clone Product Information
Gene_bank_ref_id:NM_002825.5
cDNA Size:507
cDNA Description:ORF Clone of Homo sapiens pleiotrophin DNA.
Gene Synonym:HARP, HBNF, HBGF8, NEGF1
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10288-ACG$325
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10288-ACR$325
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10288-CF$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10288-CH$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10288-CM$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10288-CY$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone)HG10288-M$95
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10288-M-F$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10288-M-H$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10288-M-N$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10288-NF$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10288-NH$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10288-NM$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10288-NY$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10288-UT$295
 Learn more about expression Vectors
Neurotrophin & Receptor Related Products
Background

HB-GAM belongs to the pleiotrophin family. During embryonic and early postnatal development, HB-GAM is expressed in the central and peripheral nervous system and also in several non-neural tissues, notably lung, kidney, gut and bone. While in the adult central nervous system, it is expressed in an activity-dependent manner in the hippocampus where it can suppress long term potentiation induction. HB-GAM has a low expression in other areas of the adult brain, but it can be induced by ischemic insults, or targeted neuronal damaged in the entorhinal cortex or in the substantia nigra pars compacta. It is structurally related to midkine and retinoic acid induced heparin-binding protein and has a high affinity for heparin. HB-GAM binds anaplastic lymphoma kinase (ALK) which induces MAPK pathway activation, an important step in the anti-apoptotic signaling of PTN and regulation of cell proliferation. It also functions as a secreted growth factor and induces neurite outgrowth and which is mitogenic for fibroblasts, epithelial, and endothelial cells.

References
  • Vanderwinden JM, et al. (1992) Cellular distribution of the new growth factor pleiotrophin (HB-GAM) mRNA in developing and adult rat tissues. Anat Embryol. 186(4):387-406.
  • Lauri SE, et al. (1996) Activity-induced enhancement of HB-GAM expression in rat hippocampal slices. Neuroreport. 7(10):1670-4.
  • Pavlov I, et al. (2002) Role of heparin-binding growth-associated molecule (HB-GAM) in hippocampal LTP and spatial learning revealed by studies on overexpressing and knockout mice. Mol Cell Neurosci. 20(2):330-42.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"