After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PDGFD cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites

Platelet-derived growth factor D (PDGF-D), also known as Iris-expressed growth factor, is a member of the PDGF/vascular endothelial growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines, seven of which are found in this factor. PDGF-D/PDGFD only forms homodimers and, therefore, does not dimerize with the other three family members. It differs from alpha and beta members of this family in having an unusual N-terminal domain, the CUB domain. The expression of PDGF-D/PDGFD in the eye is tissue-specific. In the anterior segment, it is localized to iris and ciliary body, whereas in the retina, PDGF-D/PDGFD is restricted to the outer plexiform layer. PDGF-D/PDGFD is present in aqueous humor but is not detectable in mature lens or in mouse lens-derived alphaTN4-1 cells. PDGF-D/PDGFD is highly expressed in human breast cancer and facilitates tumor growth and lymph node metastasis, making it a potential target in breast cancer. PDGF-D/PDGFD increases drug delivery and hence improves the efficacy of chemotherapy through vessel normalization. Intervention in the PDGF-D pathway in the eye, perhaps by antibody or blocking peptide, could be useful in the treatment of certain cataracts, including post-operative secondary cataract.

  • Ray S, et al. (2005) Platelet-derived growth factor D, tissue-specific expression in the eye, and a key role in control of lens epithelial cell proliferation. J Biol Chem. 280(9): 8494-502.
  • Uutela M, et al. (2004) PDGF-D induces macrophage recruitment, increased interstitial pressure, and blood vessel maturation during angiogenesis. Blood. 104 (10): 3198-204.
  • Taneda S, et al. (2004) Obstructive uropathy in mice and humans: potential role for PDGF-D in the progression of tubulointerstitial injury. J Am Soc Nephrol. 14 (10): 2544-55.
  • Images
      Recently Viewed Items