After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Prolactin R Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRLRcDNA Clone Product Information
cDNA Size:1869
cDNA Description:ORF Clone of Homo sapiens prolactin receptor DNA.
Gene Synonym:PRLR, hPRLrI
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human Prolactin R Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Related Products
Product nameProduct name

Prolactin receptor (PRLR) is a single-pass transmembrane receptor belonging to the type â…  cytokine receptor superfamily, and contains two fibronectin type-â…¢ domains. All class 1 ligands activate their respective receptors by clustering mechanisms. Ligand binding results in the transmembrane PRLR dimerization, followed by phosphorylation and activation of the molecules invloved in the signaling pathways, such as Jak-STAT, Ras/Raf/MAPK. The PRLR contains no intrinsic tyrosine kinase cytoplasmic domain but associates with a cytoplasmic tyrosine kinase, JAK2. PRLR mainly serves as the receptor for the pituitary hormone prolactin (PRL), a secreted hormone that affects reproduction and homeostasis in vertebrates. PRLR can be regulated by an interplay of two different mechanisms, PRL or ovarian steroid hormones independently or in combination in a tissue-specific manner. The role of the hormone prolactin (PRL) in the pathogenesis of breast cancer is mediated by its cognate receptor (PRLR). Ubiquitin-dependent degradation of the PRLR that negatively regulates PRL signaling is triggered by PRL-mediated phosphorylation of PRLR on Ser349 followed by the recruitment of the beta-transducin repeats-containing protein (beta-TrCP) ubiquitin-protein isopeptide ligase. which altered PRLR stability may directly influence the pathogenesis of breast cancer.

  • Bole-Feysot C, et al. (1998) Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev. 19(3): 225-68.
  • Goffin V, et al. (1999) From the molecular biology of prolactin and its receptor to the lessons learned from knockout mice models. Genet Anal. 15(3-5): 189-201.
  • Li Y, et al. (2006) Stabilization of prolactin receptor in breast cancer cells. Oncogene. 25(13): 1896-902.
  • Shao R, et al. (2008) Differences in prolactin receptor (PRLR) in mouse and human fallopian tubes: evidence for multiple regulatory mechanisms controlling PRLR isoform expression in mice. Biol Reprod. 79(4): 748-57.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
      Recently Viewed Items