Quick Order

Human PGF / PLGF Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PGFcDNA Clone Product Information
cDNA Size:513
cDNA Description:ORF Clone of Homo sapiens placental growth factor DNA.
Gene Synonym:PGF, PGFL, PLGF, PlGF-2, D12S1900, SHGC-10760
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human PGF / PLGF Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Vascular Endothelial Growth Factor (VEGF) & Receptor Related Products
Product nameProduct name
Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 ProteinHuman VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGF121 / VEGF-A ProteinHuman Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human Neuropilin 2 / NRP2 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGF-B / VEGFB Protein (Fc Tag)Human VEGF121 / VEGF-A ProteinHuman VEGF121b / VEGF-A ProteinMouse PIGF / PLGF Protein (Fc Tag)Mouse PIGF / PLGF ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Mouse VEGF-D / VEGFD / FIGF Protein (His Tag)Mouse VEGFA / VEGF164 ProteinMouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Danio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinCanine VEGF / VEGFA ProteinRat VEGF164 / VEGFA ProteinRat VEGFR1 / FLT-1 Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)
  • Nagy JA, et al. (2003) VEGF-A(164/165) and PlGF: roles in angiogenesis and arteriogenesis. Trends Cardiovasc Med. 13(5): 169-75.
  • Chaballe L, et al. (2011) Placental growth factor: a tissue modelling factor with therapeutic potentials in neurology? Acta Neurol Belg. 111(1): 10-7.
  • Odorisio T, et al. (2006) The placenta growth factor in skin angiogenesis. J Dermatol Sci. 41(1): 11-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
      Recently Viewed Items