Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FKBP1A cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-GFPSpark tagHG10268-ACG$325
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10268-ACR$325
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-GFPSpark tagHG10268-ANG$325
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10268-ANR$325
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-Flag tagHG10268-CF$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-His tagHG10268-CH$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-Myc tagHG10268-CM$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-HA tagHG10268-CY$295
Human FKBP1A / FKBP12 transcript variant 12B Gene cDNA clone plasmidHG10268-M$95
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, Flag tagHG10268-M-F$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-Flag tagHG10268-NF$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-His tagHG10268-NH$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-Myc tagHG10268-NM$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-HA tagHG10268-NY$295
Human FKBP1A / FKBP12 transcript variant 12B natural ORF mammalian expression plasmidHG10268-UT$295
 Learn more about expression Vectors
Product nameProduct name

FK506 binding protein 12 (FKBP12), also known as FKBP1, along with cyclophilin, are two major members of the immunophilin protein family who serve as receptors for the immunosuppressant drugs cyclosporin A and FK506. As a conserved molecules in many eukaryotes, FKBP12 has been characterized as a peptidyl-prolyl isomerase that catalyzes the transition between cis- and trans-proline residues, and is involved in several biochemical processes including protein folding, receptor signaling, protein trafficking and transcription. FKBP12 has attracted immense attention and its role in mediating the immunosuppressive functions. FKBP12 serves a dual role as a peptidyl-prolyl cis-trans isomerase and as a modulator of several cell signaling pathways. In one such a role, FKBP12 interacts with and regulates the functional state of the ryanodine Ca2+ channel receptor by altering protein conformation and coordinating multi-protein complex formation. Another physiological role of FKBP12 is an interactor and a regulator of the type I serine/threonine kinase receptors of TGF-beta superfamily. Current data, derived from detailed biochemical studies as well as from functional studies in various systems, suggest that FKBP12 functions as a "guardian" for the type I receptors to prevent them from leaky signaling under sub-optimal ligand concentrations, thereby providing a molecular "gradient reader" for TGF-beta family morphogens. This aspect of FKBP12 function may be critical for cellular responsiveness to morphogenetic gradients of the TGF-beta family members during early development, serving to assure the translation of different ligand concentrations into different signaling readouts. In addition, FKBP12 may be involved in neuronal or astrocytic cytoskeletal organization and in the abnormal metabolism of tau protein in Alzheimer's disease (AD) damaged neurons.

  • Wang T, et al. (2004) The immunophilin FKBP12: a molecular guardian of the TGF-beta family type I receptors. Front Biosci. 9: 619-31.
  • Sugata H, et al. (2009) A peptidyl-prolyl isomerase, FKBP12, accumulates in Alzheimer neurofibrillary tangles. Neurosci Lett. 459(2): 96-9.
  • Brath U, et al. (2009) Differential responses of the backbone and side-chain conformational dynamics in FKBP12 upon binding the transition-state analog FK506: implications for transition-state stabilization and target protein recognition. J Mol Biol. 387(1): 233-44.
  • Scaramello CB, et al.. (2009) FKBP12 depletion leads to loss of sarcoplasmic reticulum Ca(2+) stores in rat vas deferens. J Pharmacol Sci. 109(2): 185-92.
  • Images
      Recently Viewed Items