Quick Order

Text Size:AAA

Mouse KLRB1A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KLRB1AcDNA Clone Product Information
Gene_bank_ref_id:NM_010737.3
cDNA Size:702
cDNA Description:ORF Clone of Mus musculus killer cell lectin-like receptor subfamily B member 1A DNA.
Gene Synonym:Ly55a, NKRP12, Nkrp1a, NKR-P1A, Nkrp1-a, Klrb1a
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
References
  • Plougastel B, et al. (2001) Analysis of a 1-Mb BAC contig overlapping the mouse Nkrp1 cluster of genes: cloning of three new Nkrp1 members, Nkrp1d, Nkrp1e, and Nkrp1f. Immunogenetics 53: 592-598.
  • Kogelberg H, et al. (2000) Expression in Escherichia coli, folding in vitro, and characterization of the carbohydrate recognition domain of the natural killer cell receptor NKR-P1A. Protein Expr Purif. 20(1): 10-20.
  • Grazia Cifone M, et al. (1997) NKR-P1A stimulation of arachidonate-generating enzymes in rat NK cells is associated with granule release and cytotoxic activity. J Immunol. 159(1): 309-17.
  • Josien R, et al. (1997) Rat spleen dendritic cells express natural killer cell receptor protein 1 (NKR-P1) and have cytotoxic activity to select targets via a Ca2+-dependent mechanism. J Exp Med. 186: 467-472.
  • Ryan JC, et al. (1995) NKR-P1A is a target-specific receptor that activates natural killer cell cytotoxicity. J Exp Med. 181(5): 1911-5.
  • Lanier L L, et al. (1994) Human NKR-P1A: a disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol. 153: 2417-2428.
  • Chambers W, et al. (1989) Monoclonal antibody to a triggering structure expressed on rat natural killer cells and adherent lymphokine-activated killer cells. J Exp Med. 169: 1373-1389.
  • Size / Price
    Catalog:MG50806-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"