Quick Order

Mouse USH1C Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
USH1CcDNA Clone Product Information
Gene_bank_ref_id:NM_023649.2
cDNA Size:1647
cDNA Description:ORF Clone of Mus musculus Usher syndrome 1C homolog (human) DNA.
Gene Synonym:harmonin, 2010016F01Rik, Ush1c
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Harmonin, also known as Antigen NY-CO-38 / NY-CO-37, Autoimmune enteropathy-related antigen AIE-75, Protein PDZ-73, Renal carcinoma antigen NY-REN-3, Usher syndrome type-1C protein and USH1C, is a protein which is expressed in small intestine, colon, kidney, eye and weakly in pancreas. USH1C is expressed also in vestibule of the inner ear. USH1C contains 3 PDZ (DHR) domains. USH1C may be involved in protein-protein interaction. Defects in USH1C are the cause of Usher syndrome type 1C (USH1C), also known as Usher syndrome type I Acadian variety. USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa and sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). Defects in USH1C are also the cause of deafness autosomal recessive type 18 (DFNB18) which is a form of sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

References
  • Verpy, E. et al., 2000, Nat Genet. 26 (1):51-5.
  • Weil D., et al., 2003, Hum. Mol. Genet. 12:463-471.
  • Reiners,J. et al., 2005, Hum Mol Genet. 14 (24):3933-43.
  • Yan,D. et al., 2006, Mol Biol. 357 (3):755-64.
  • Size / Price
    Catalog:MG50803-NM
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"