After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACVR2B cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman ALK-2 / ACVR1 Protein (His & Fc Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human TGFBR2 Protein (His & Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human BAMBI / NMA Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinRat Cripto / TDGF1 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Rhesus ACVR1B / ALK-4 Protein (Fc Tag)Mouse BAMBI / NMA Protein (Fc Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rhesus TGFBR2 Protein (Fc Tag)Rhesus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Mouse Smad5 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

ACVR2A and ACVR2B are two activin type II receptors. ACVR2B is integral to the activin and myostatin signaling pathway. Ligands such as activin and myostatin bind to ACVR2A and ACVR2B. Myostatin, a negative regulator of skeletal muscle growth, is regarded as a potential therapeutic target and binds to ACVR2B effectively, and to a lesser extent, to ACVR2A. The structure of human ACVR2B kinase domain in complex with adenine establishes the conserved bilobal architecture consistent with all other catalytic kinase domains. Haplotype structure at the ACVR2B and follistatin loci may contribute to interindividual variation in skeletal muscle mass and strength. Defects in ACVR2B are a cause of left-right axis malformations.

  1. Kosaki R, et al. (1999) Left-right axis malformations associated with mutations in ACVR2B, the gene for human activin receptor type IIB. Am J Med Genet. 82(1):70-6.
  2. Dupont S, et al. (2001) No evidence for linkage or for diabetes-associated mutations in the activin type 2B receptor gene (ACVR2B) in French patients with mature-onset diabetes of the young or type 2 diabetes. Diabetes 50(5):1219-21.
  3. Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.
  4. Walsh S, et al. (2007) Activin-type II receptor B (ACVR2B) and follistatin haplotype associations with muscle mass and strength in humans. J Appl Physiol. 102(6):2142-8.
    Recently Viewed Items