After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SCG2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SCG2cDNA Clone Product Information
Gene_bank_ref_id:BC022509
cDNA Size:1854
cDNA Description:ORF Clone of Homo sapiens secretogranin II (chromogranin C) DNA.
Gene Synonym:SN, CHGC, SgII, SCG2
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Kit ligand, also known as Hematopoietic growth factor KL, Mast cell growth factor, Steel factor, Stem cell factor, c-Kit ligand, Kitlg and KITL, is a single-pass type I membrane protein which belongs to the SCF family. KITL / kit ligand also belongs to the family of dimeric transmembrane growth factors. The soluble form of KIT ligand is a secreted protein. Mast cells are thought to participate in a variety of immune responses, such as parasite resistance and the allergic reaction. Mast cell development depends on stem cell factor (Kit ligand) and its receptor, c-Kit. KITL / kit ligand stimulates the proliferation of mast cells. KITL / kit ligand is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. Efficient cell surface presentation of KITL / kit ligand is essential for the migration, proliferation, and survival of melanocytes, germ cells, hemopoietic stem cells, and mastocytes. KITL / kit ligand acts synergistically with other cytokines, probably interleukins. KITL / kit ligand plays a crucial role in the development and maintenance of the melanocyte lineage in adult skin. It exerts permanent survival, proliferation and migration functions in Kit receptor-expressing melanocytes. KITL / kit ligand misexpression in some hyperpigmented lesions may open the avenue for Kitl-dependent treatment of pathological skin conditions.

References
  • Nishida,K.et al., 2002, Blood. 99 (5):1866-9.
  • Paulhe,F. et al., 2004,J Biol Chem. 279 (53):55545-55.
  • Fernandez,S.M. et al., 2008,Biol Reprod. 79 (2):318-27.
  • Wehrle-Haller,B. et al., 2003,Pigment Cell Res.16 (3):287-96.
  • Size / Price
    Catalog:HG13441-NY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"