After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GFRA3 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GFRA3cDNA Clone Product Information
cDNA Size:1203
cDNA Description:ORF Clone of Homo sapiens GDNF family receptor alpha 3 DNA.
Gene Synonym:GFRA3
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Glial cell line-Derived Neurotrophic Factor (GDNF) Related Products
Product nameProduct name

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 3 (GFRA3) or GDNFRa3 is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA3 / GDNFRa3 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. The neurotrophic growth factor artemin binds selectively to GDNF family receptor α3 (GFRA3 / GDNFRa3), forming a molecular complex with the co-receptor RET which mediates downstream signaling. This signaling pathway has been demonstrated to play an important role in the survival and maintenance of nociceptive sensory neurons and in the development of sympathetic neurons.

  • Widenfalk J, et al. (2000) Neurturin, RET, GFRalpha-1 and GFRalpha-2, but not GFRalpha-3, mRNA are expressed in mice gonads. Cell Tissue Res. 299(3): 409-15.
  • Li J, et al. (2009) Autocrine regulation of early embryonic development by the artemin-GFRA3 (GDNF family receptor-alpha 3) signaling system in mice. FEBS Lett. 583(15): 2479-85.
  • Yang C, et al. (2006) Distribution of GDNF family receptor alpha3 and RET in rat and human non-neural tissues. J Mol Histol. 37(1-2): 69-77.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days