Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSF1R cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human M-CSF / CSF-1 ProteinCynomolgus / Rhesus M-CSF / CSF-1 Protein (Fc Tag)Cynomolgus / Rhesus M-CSF / CSF-1 Protein (His Tag)Human M-CSF / CSF-1 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse M-CSF / CSF-1 ProteinHuman M-CSF / CSF-1 Protein (His Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human / Cynomolgus M-CSF / CSF-1 Protein (His Tag)Human G-CSFR / CD114 Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Mouse M-CSF / CSF-1 Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinRat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 ProteinHuman M-CSF / CSF-1 Protein (Fc Tag)

M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine involved in the proliferation, differentiation, and activation of macrophages. This cell surface glycoprotein is consisted by an extracellular ligand-binding domain, a single membrane-spanning segment, and an intracellular tyrosine kinase domain. Binding of CSF1 activates the receptor kinase, leading to "autophosphorylation" of receptor subunits and the concomitant phosphorylation of a series of cellular proteins on tyrosine residues. CSF1R is a tyrosine kinase receptor that is absolutely required for macrophage differentiation and thus occupies a central role in hematopoiesis. CSF1 and its receptor (CSF1R, product of c-fms proto-oncogene) were initially implicated as essential for normal monocyte development as well as for trophoblastic implantation. This apparent role for CSF1/CSF1R in normal mammary gland development is very intriguing because this receptor/ligand pair has also been found to be important in the biology of breast cancer in which abnormal expression of CSF1 and its receptor correlates with tumor cell invasiveness and adverse clinical prognosis. Tumor cell expression of CSF1R is under the control of several steroid hormones (glucocorticoids and progestins) and the binding of several bHLH transcription factors, while tumor cell expression of CSF-1 appears to be regulated by other hormones, some of which are involved in normal lactogenic differentiation. However, studies have demonstrated that CSF1 and CSF1R have additional roles in mammary gland development during pregnancy and lactation. The role of CSF1 and CSF1R in normal and neoplastic mammary development that may elucidate potential relationships of growth factor-induced biological changes in the breast during pregnancy and tumor progression.

  • Sherr CJ. (1990) The colony-stimulating factor 1 receptor: pleiotropy of signal-response coupling. Lymphokine Res. 9(4): 543-8.
  • Kacinski BM. (1997) CSF-1 and its receptor in breast carcinomas and neoplasms of the female reproductive tract. Mol Reprod Dev. 46(1): 71-4.
  • Sapi E, et al. (1999) The role of CSF-1 in normal and neoplastic breast physiology. Proc Soc Exp Biol Med. 220(1): 1-8.
  • Sapi E. (2004) The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood). 229(1): 1-11.
  • Bonifer C, et al. (2008) The transcriptional regulation of the Colony-Stimulating Factor 1 Receptor (csf1r) gene during hematopoiesis. Front Biosci. 13: 549-60.
  • Images
      Recently Viewed Items