After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PDIA4 ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human PDIA4 cDNA Clone Product Information
NCBI RefSeq:BC000425
RefSeq ORF Size:1938bp
cDNA Description:Full length Clone DNA of Homo sapiens protein disulfide isomerase family A, member 4 with N terminal HA tag.
Gene Synonym:ERP70, ERP72, ERp-72, PDIA4
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ERP72, also known as PDIA4, is an endoplasmic reticulum luminal protein which belongs to the protein disulfide isomerase family. ERP72 is a stress protein and participates in the catalysis of protein-S-S-bond rearrangement. Both of PDIA4 and PDIA3 function as proteases, protein disulfide isomerases, phospholipases or an arrangement of these. ERP72 compose part of a large chaperone multiprotein complex comprising CABP1, DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PPIB, SDF2L1, UGT1A1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX.

References
  • Tsai YC, et al. (2012) Functional proteomics establishes the interaction of SIRT7 with chromatin remodeling complexes and expands its role in regulation of RNA polymerase I transcription. Mol Cell Proteomics. 11(5):60-76.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.
  • Size / Price
    Catalog: HG13333-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"