Quick Order

Mouse HBP1 ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse HBP1 cDNA Clone Product Information
NCBI RefSeq:NM_177993.3
RefSeq ORF Size:1425bp
cDNA Description:Full length Clone DNA of Mus musculus high mobility group box transcription factor 1 with C terminal Flag tag.
Gene Synonym:C86454, BE629963, 1700058O05Rik, C330012F01Rik
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

HBP1 is a sequence-specific DNA-binding transcription factor. It is involved in many biological processes. It was reported that HBP1 binds to p16(INK4A) promoter and activates p16(INK4A) expression. We found that trichostatin A (TSA), an inhibitor of HDAC (histone deacetylase), induces p16(INK4A) expression in an HBP1-dependent manner. HBP1 activates or represses the expression of some specific genes during cell growth and differentiation. HBP1 was acetylated by p300/CBP in two regions: repression domain (K297/305/307) and P domain (K171/419). HBP1 acetylation after TSA treatment was confirmed by immunoprecipitation assay. HBP1 interacted with histone acetyltransferase p300 and CREB-binding protein (CBP) and also recruited p300/CBP to p16(INK4A) promoter. HBP1 acetylation at K419 plays an important role in HBP1-induced p16(INK4A) expression.

References
  • Tevosian SG. et al., 1997, Genes Dev. 11 (3): 383-96.
  • Lavender P. et al., 1997, Oncogene. 14 (22): 2721-8.
  • Swanson. et al., 2004, Nat Struct Mol Biol. 11 (8): 738-46.
  • Size / Price
    Catalog: MG51538-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"