Quick Order

Text Size:AAA

Mouse BLMH Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BLMHcDNA Clone Product Information
Gene_bank_ref_id:NM_178645.4
cDNA Size:1368
cDNA Description:ORF Clone of Mus musculus bleomycin hydrolase DNA.
Gene Synonym:Bh, Bmh, AI035728, MGC36899, MGC37104, MGC39026, Blmh
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

The papain superfamily member bleomycin hydrolase (BLMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution. The only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The papain superfamily member bleomycin hydrolase (BLMH) is a neutral cysteine protease with structural similarity to a 20S proteasome. Bleomycin (BLM), a clinically used glycopeptide anticancer agent. BLMH is an essential protectant against BLM-induced death and has an important role in neonatal survival and in maintaining epidermal integrity. Sequencing revealed several putative sites phosphorylated by different types of protein kinases, but no signal sequence, transmembrane domain, N-linked glycosylation site or DNA-binding motif.

References
  • Takeda A, et al. (1996) Cloning and Analysis of cDNA Encoding Rat Bleomycin Hydrolase, a DNA-Binding Cysteine Protease. J Biochem. 120 (2): 353-9.
  • Lefterov IM, et al. (2000) Human bleomycin hydrolase regulates the secretion of amyloid precursor protein. The FASEB Journal. 14(12): 1837-47.
  • Brmme D, et al. (1996) Human Bleomycin Hydrolase: Molecular Cloning, Sequencing, Functional Expression, and Enzymatic Characterization. Biochemistry. 35 (21): 6706-14.
  • Size / Price
    Catalog:MG50668-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"