Quick Order

Mouse TXNL4A ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TXNL4A cDNA Clone Product Information
Gene_bank_ref_id:NM_025299.3
RefSeq ORF Size:429bp
cDNA Description:Full length Clone DNA of Mus musculus thioredoxin-like 4A with N terminal Flag tag.
Gene Synonym:Dim1; Txnl4; U5-15kD; U5-15kDa; D18Wsu98e; ENSMUSG00000057130
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

DIM1, also known as TXNL4A, is a member of the Dim protein family. The Dim protein family is composed of two classes, DIM1and Dim2, which share a common thioredoxin-like fold. They were originally identified for their role in cell cycle progression and have been found to interact with Prp6, an essential component of the spliceosome, which forms the bridge of U4/U6.U5-tri-snRNP. In spite of their biological and structural similarities, DIM1 and Dim2 proteins differ in many aspects. DIM1 bears distinctive structural motifs responsible for its interaction with other spliceosome components. Dim2 forms homodimers and contains specific domains required for its interactions with partners. This originality suggests that although both proteins are involved in pre-mRNA splicing, they are likely to be involved in different biological pathways. DIM1 interacts with HNRPF, HNRPH2, NEDD9/HEF1 and PQBP1/NPW38. It plays an essential role in pre-mRNA splicing.

References
  • Zhang Y, et al. (2001) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1): 33-43.
  • Zhang YZ, et al. (2003) Structure, stability, and function of hDim1 investigated by NMR, circular dichroism, and mutational analysis. Biochemistry. 42(32):9609-18.
  • Zhang Y, et al. (2000) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1):33-43.
  • Zhang YZ, et al. (2000) The evolutionarily conserved Dim1 protein defines a novel branch of the thioredoxin fold superfamily. Physiol Genomics. 1(3):109-18.
  • Size / Price
    Catalog: MG51571-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"