After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse Serpinb10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINB10cDNA Clone Product Information
cDNA Size:1194
cDNA Description:ORF Clone of Mus musculus serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10 DNA.
Gene Synonym:BB233602, 9830131G07, Serpinb10
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mouse Serpinb10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified.
Mouse SerpinB10, also known as Peptidase inhibitor 10, PI-10, Bomapin and SERPINB10, is a nucleus and cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB10 is expressed specifically in the bone marrow. SerpinB10 is a protease inhibitor that may play a role in the regulation of protease activities during hematopoiesis and apoptosis induced by TNF. SerpinB10 is a redox-sensitive nuclear serpin that augments proliferation or apoptosis of leukaemia cells, depending on growth factors availability. SerpinB10 may regulate protease activities in the cytoplasm and in the nucleus.

  • Riewald M. et al., 1995, J. Biol. Chem. 270: 26754-7.
  • Forsyth, S. et al., 2003, Genomics 81: 336-45. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30.