Quick Order

Text Size:AAA

Mouse PLK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLK1cDNA Clone Product Information
cDNA Size:1812
cDNA Description:ORF Clone of Mus musculus polo-like kinase 1 (Drosophila) DNA.
Gene Synonym:Plk, STPK13, Plk1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Serine / threonine-protein kinase PLK1 / PLK-1, also known as polo-like kinase 1 (PLK-1) or serine / threonine-protein kinase 13 (STPK13), Polo-like kinases (PLKs), is a family of four serine / threonine protein kinases that are critical regulators of cell cycle progression, mitosis, cytokinesis, and the DNA damage response. PLK1 / PLK-1 is ubiquitously expressed. The mRNA and protein expression of PLK1 / PLK-1, -2 and -4 are coordinately regulated during cell cycle progression, but PLK3 levels are independent of the other three family members. PLK1 / PLK-1 is the most well characterized member of this family and strongly promotes the progression of cells through mitosis. During the various stages of mitosis PLK1 / PLK-1 localizes to the centrosomes, kinetochores and central spindle. PLKs are dysregulated in a variety of human cancers. PLK1 / PLK-1 overexpression correlates with cellular proliferation and poor prognosis. Serine / threonine-protein kinase that performs several important functions throughout M phase of the cell cycle, including the regulation of centrosome maturation and spindle assembly, the removal of cohesins from chromosome arms, the inactivation of APC / C inhibitors, and the regulation of mitotic exit and cytokinesis. It is required for recovery after DNA damage checkpoint and entry into mitosis. PLK1 / PLK-1 is required for kinetochore localization of BUB1B, spindle pole localization of isoform 3 of SGOL1 and plays a role in regulating its centriole cohesion function. PLK1 / PLK-1 Phosphorylates BORA, and thereby promotes the degradation of BORA. PLK1 / PLK-1 also contributes to the regulation of AURKA function and phosphorylates SGOL1.

  • Lee KS, et al. (2008) Self-regulated mechanism of Plk1 localization to kinetochores: lessons from the Plk1-PBIP1 interaction. Cell Div. 3: 4.
  • Zhou T, et al. (2003) A role for Plk1 phosphorylation of NudC in cytokinesis. Dev Cell. 5 (1): 127-38.
  • Lee M, et al. (2004) Phosphorylation of BRCA2 by the Polo-like kinase Plk1 is regulated by DNA damage and mitotic progression. Oncogene. 23 (4): 865-72.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items