Quick Order

Mouse SLAMF8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SLAMF8cDNA Clone Product Information
Gene_bank_ref_id:NM_029084.3
cDNA Size:837
cDNA Description:ORF Clone of Mus musculus SLAM family member 8 DNA.
Gene Synonym:Blame, SBBI42, 5830408F06Rik, Slamf8
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

The signaling lymphocyte activation molecule (SLAM) family includes homophilic and heterophilic receptors that modulate both adaptive and innate immune responses. These receptors share a common ectodomain organization: a membrane-proximal immunoglobulin constant domain and a membrane-distal immunoglobulin variable domain that is responsible for ligand recognition. SLAM family of receptors is expressed by a wide range of immune cells. Through their cytoplasmic domain, SLAM family receptors associate with SLAM-associated protein (SAP)-related molecules, a group of cytoplasmic adaptors composed almost exclusively of an SRC homology 2 domain. SLAM family receptors, in association with SAP family adaptors, have crucial roles during normal immune reactions in innate and adaptive immune cells.
Mouse SLAM family member 8, also known as B-lymphocyte activator macrophage expressed, BCM-like membrane protein, SLAMF8 and BLAME, is a single-pass type I  membrane protein. It contains one Ig-like C2-type (immunoglobulin-like) domain. SLAMF8 / BLAME is expressed in lymph node, spleen, thymus and bone marrow. It may play a role in B-lineage commitment and/or modulation of signaling through the B-cell receptor.

References
  • Kingsbury G.A., et al., 2001, J. Immunol. 166:5675-80.
  • Zhang Z., et al., 2004, Protein Sci. 13: 2819-24.
  • Veillette,A. et al., 2006, Nat Rev Immunol  6 (1): 56-66.
  • Veillette,A. et al., 2006, Trends Immunol  27 (5): 228-34.
  • Yan,Q. et al., 2007, Proc Natl Acad Sci. USA.104 (25):10583-8.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"