After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BPIFB1 / C20ORF114 ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human BPIFB1 cDNA Clone Product Information
NCBI RefSeq:BC008429
RefSeq ORF Size:1455bp
cDNA Description:Full length Clone DNA of Homo sapiens chromosome 20 open reading frame 114 with N terminal HA tag.
Gene Synonym:LPLUNC1, C20orf114, BPIFB1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

BPIFB1, also known as LPLUNC1, belongs to the BPI/LBP/Plunc superfamily, plunc family. BPIFB1 may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. BPIFB1 is expressed in the upper respiratory tract and oral cavity, which may function in host defence. The expression of BPIF proteins is associated with CF lung disease in humans and mice. It is unclear if this elevation of protein production, which results from phenotypic alteration of the cells within the diseased epithelium, plays a role in the pathogenesis of the disease. BPIFB1 is an abundant, secreted product of goblet cells and minor mucosal glands of the respiratory tract and oral cavity and suggest that the protein functions in the complex milieu that protects the mucosal surfaces in these locations.

Size / Price
Catalog: HG13275-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"